Journal of Hematology, ISSN 1927-1212 print, 1927-1220 online, Open Access
Article copyright, the authors; Journal compilation copyright, J Hematol and Elmer Press Inc
Journal website http://www.thejh.org

Original Article

Volume 8, Number 3, September 2019, pages 89-101

Changes in IDH2, TET2 and KDM2B Gene Expression After Treatment With Classic Chemotherapeutic Agents and Decitabine in Myelogenous Leukemia Cell Lines

Figures

Figure 1.
Figure 1. Decitabine dose curves in the KASUMI-1 cell line (a) and in the K-562 cell line (b). P values were determined using one-way ANOVA, followed by the Tukey post-hoc test (parametric), or using Kruskal-Wallis test, followed by Dunn’s multiple correlations test (non-parametric), using P < 0.05 for statistically significant differences. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Results are expressed as absolute cell counts.
Figure 2.
Figure 2. Cell counts after 24 and 48 h of treatment with doxorubicin (a), etoposide (b), vincristine (c), cytarabine (d) and methotrexate (e) in the KASUMI-1 cell line alone or in association with decitabine. The differences shown are in relation to treatment with decitabine. Values were determined using one-way ANOVA, followed by the Tukey post-hoc test (parametric), or Kruskal-Wallis test, followed by Dunn’s multiple correlations test (non-parametric), where P < 0.05 values determined statistically significant differences. a: P < 0.05, b: P < 0.01, c: P < 0.001, d: P < 0.0001. Results are expressed as absolute cell counts.
Figure 3.
Figure 3. Cell counts after 24 and 48 h of treatment with doxorubicin (a), etoposide (b), vincristine (c), cytarabine (d) and methotrexate (e) in the K-562 cell line. The differences shown are in relation to treatment with decitabine. P values were determined using the Kruskal-Wallis test, followed by Dunn’s multiple correlation test, using P < 0.05 to determine statistically significant differences. */a: P < 0.05, b: P < 0.01, c/***: P < 0.001, d: P < 0.0001; values of P represented in letters are relative to decitabine; values of P represented in * are relative to the isolated chemotherapeutic treatment. Results are expressed as absolute cell counts.
Figure 4.
Figure 4. IDH2 gene expression levels in the KASUMI-1 cell line after treatment with (a) doxorubicin, (b) etoposide, (c) vincristine, (d) cytarabine, and (e) methotrexate, and in the K-562 cell line after treatment with (f) doxorubicin, (g) etoposide, (h) vincristine, (i) cytarabine, and (j) methotrexate. The differences shown are in relation to treatment with decitabine. P values were determined using one-way ANOVA, followed by the Tukey post-hoc test, using P < 0.05 to determine statistically significant differences. a/*: P < 0.05, b/**: P < 0.01, c/***: P < 0.001, d/****: P < 0.0001; values of P represented in letters are relative to decitabine; values of P represented in * are relative to the isolated control or chemotherapeutic agent.
Figure 5.
Figure 5. KDM2B gene expression levels in the KASUMI-1 cell line after treatment with (a) doxorubicin, (b) etoposide, (c) vincristine, (d) cytarabine, and (e) methotrexate, and in the K-562 cell line after treatment with (f) doxorubicin, (g) etoposide, (h) vincristine, (i) cytarabine, and (j) methotrexate. The differences shown are in relation to treatment with decitabine. P values were determined using one-way ANOVA, followed by the Tukey post-hoc test, using P < 0.05 to determine statistically significant differences. a/*: P < 0.05, b/**: P < 0.01, c/***: P < 0.001, d/****: P < 0.0001; values of P represented in letters are relative to decitabine; values of P represented in * are relative to the isolated control or chemotherapeutic agent.
Figure 6.
Figure 6. TET2 gene expression level in the KASUMI-1 cell line after treatment with (a) doxorubicin, (b) etoposide, (c) vincristine, (d) cytarabine, and (e) methotrexate, and in the K-562 cell line after treatment with (f) doxorubicin, (g) etoposide, (h) vincristine, (i) cytarabine, and (j) methotrexate. The differences shown are in relation to treatment with decitabine. P values were determined using one-way ANOVA, followed by the Tukey post-hoc test using P < 0.05 to determine statistically significant differences. a/*: P < 0.05, b/**: P < 0.01, c/***: P < 0.001, d/****: P < 0.0001; values of P represented in letters are relative to decitabine; values of P represented in * are relative to the isolated control or chemotherapeutic agent.

Tables

Table 1. Forward and Reverse Primers Used for Gene Amplification
 
GenePrimers 5’ - 3’Temperature (°C)Size (bp)
IDH2Forward: ATGCCATCCAGAAGAAATGG59.89175
Reverse: TGAGCCACCATGTCATCAAT59.93
TET2Forward: TTGCAATGAGATACCCCACA59.92200
Reverse: TGCAAACCAACAAAGATGGA60.09
KDM2BForward: ACAACAAGGAAGGGCAGGAA59.44196
Reverse: CCAGGTTTGAGCCGCTTG59.04
ACTBForward: AAACTGGAACGGTGAAGGTG60.01171
Reverse: AGAGAAGTGGGGTGGCTTTT60.11
GAPDHForward: CTTTGTCAAGCTCATTTCCTGG54.20133
Reverse: TCTTCCTCTTGTGCTCTTGC54.90

 

Table 2. Standardization of qPCR Reaction for IDH2, TET2 and KDM2B Genes in the K-562 Cell Line
 
ReagentIDH2 (60 °C)TET2 (59 °C)KDM2B (60 °C)
qPCR: quantitative real-time polymerase chain reaction; dNTPs: deoxyribonucleoside triphosphates; cDNA: complementary DNA.
Ultrapure water3.85 µL3.85 µL3.5 µL
Buffer (10 ×)2 µL2 µL2 µL
MgCl2 (50 nM)1.2 µL (3 nM)1.2 µL (3 nM)1.5 µL (3.75 nM)
dNTPs (10 mM)--0.1 µL (0.05 mM)
dNTPs (5 mM)0.1 µL (0.025 mM)0.1 µL (0.025 mM)-
Primer foward (10 mM)0.4 µL (0.2 mM)0.4 µL (0.2 mM)0.4 µL (0.2 mM)
Primer reverse (10 mM)0.4 µL (0.2 mM)0.4 µL (0.2 mM)0.4 µL (0.2 mM)
SYBR Green2 µL2 µL2 µL
Taq Platinum (5 U/µL)0.05 µL0.05 µL0.1 µL
cDNA (1:15)10 µL10 µL10 µL
Total20 µL20 µL20 µL

 

Table 3. Standardization of qPCR Reaction for IDH2, TET2 and KDM2B Genes in the KASUMI-1 Cell Line
 
ReagentIDH2 (60 °C)TET2 (59 °C)KDM2B (60 °C)
qPCR: quantitative real-time polymerase chain reaction; dNTPs: deoxyribonucleoside triphosphates; cDNA: complementary DNA.
Ultrapure water3.6 µL3.6 µL3.5 µL
Buffer (10 ×)2 µL2 µL2 µL
MgCl2 (50 mM)1.2 µL (3 mM)1.2 µL (3 mM)1.5 µL (3.75 mM)
dNTPs (10 mM)0.1 µL (0.05 mM)0.1 µL (0.05 mM)0.1 µL (0.05 mM)
Primer forward (10 mM)0.5 µL (0.25 mM)0.5 µL (0.25 mM)0.4 µL (0.2 mM)
Primer reverse (10 mM)0.5 µL (0.25 mM)0.5 µL (0.25 mM)0.4 µL (0.2 mM)
SYBR Green2 µL2 µL2 µL
Taq Platinum (5 U/µL)0.1 µL0.1 µL0.1 µL
cDNA (1:15)--10 µL
cDNA (1:45)10 µL10 µL-
Total20 µL20 µL20 µL